Attachment 'bsubtilis.285000-290999.txt'

Download

   1 TTTAACGACTATCGCGGATATGTCCGCTGTACAGTGACGCCTCACCAAGTGGAAAGCCGA
   2 TTATCGGGTGATGCCATTTGTGACCGAGCCGGGCGCAGCCATTTCCACGCGGGCTTCATT
   3 CGTTTACCAGAAAGACCAAACCGGGTTGAGAAAGGTATCATCCACAACAATCCAAGGCGG
   4 GGTGAAGCAATCCGATGAGGTCGAAGAGGATCGTTTCTTTTCGCACAACAAAGCCCACGA
   5 AAAACAAATGATTAAGAAGCGTGCAAAAATCACGAATTAAGGAGTGGAAATTATGTTTTC
   6 AAACATTGGAATACCGGGCTTGATTCTCATCTTCGTCATCGCCCTCATTATTTTTGGCCC
   7 TTCCAAGCTGCCGGAAATCGGGCGTGCCGCCGGACGGACACTGCTGGAATTTAAAAGCGC
   8 CACAAAATCACTTGTGTCTGGTGATGAAAAAGAAGAGAAATCAGCTGAGCTGACAGCGGT
   9 AAAGCAGGACAAAAACGCGGGCTGAATGCTGATGAGGCAGACACCGGGTCTGCCTCTTTT
  10 TTTATGAAAGGGAGGGCTTTTTTGAATGGATAAAAAAGAAACCCATCTGATCGGGCATTT
  11 AGAAGAGCTTCGCCGCCGGATTATCGTCACCCTTGCGGCATTTTTTCTATTTCTCATCAC
  12 GGCTTTTTTGTTCGTACAGGACATTTATGACTGGCTGATCAGGGATTTGGATGGAAAGCT
  13 GGCTGTGCTAGGACCGAGTGAAATCCTCTGGGTGTATATGATGCTTTCCGGCATTTGTGC
  14 CATTGCGGCTTCTATCCCTGTTGCCGCGTACCAGCTGTGGCGTTTCGTTGCACCGGCGCT
  15 GACTAAAACGGAGCGCAAGGTGACGCTCATGTACATCATGTACATACCAGGTTTATTTGC
  16 GTTGTTTTTGGCGGGCATCTCCTTCGGATACTTTGTCTTGTTTCCGATCGTGCTCAGCTT
  17 TTTGACTCATTTATCCTCCGGCCACTTTGAAACGATGTTTACGGCTGACCGCTACTTTAG
  18 GTTTATGGTGAATTTGAGCCTGCCGTTCGGCTTCTTGTTTGAGATGCCCTTGGTGGTGAT
  19 GTTTTTAACAAGGCTGGGCATCTTAAATCCTTACAGACTGGCCAAAGCGAGAAAGCTTTC
  20 CTATTTTCTGCTGATTGTCGTGTCCATATTGATTACACCGCCTGATTTTATTTCTGATTT
  21 TCTCGTGATGATCCCGCTTCTTGTCCTGTTTGAAGTGAGTGTCACCCTATCGGCGTTTGT
  22 CTACAAAAAGAGGATGAGGGAAGAAACAGCGGCGGCCGCTTAGTGCAGCGTACCACCCGG
  23 TGACTTCACATCCTCATCATATTGTGCGGCCGTAACAGCGGCGATTCTCAATGCCCGGAC
  24 AATCGTGTCCAGGCTGAGGCTCGGCGCTGTTTTGTCGATTGTTTGCTGCGGAATGTAAGG
  25 AATATGAATAAAACCGCCGCGAATGTGTGGGGATGTCCGGCTAATGTGATCCATTAACCC
  26 GTAGAACAAATAGTTGCATACAAAGGTCCCCGCTGTGTAGGAAACCGCAGCTGGAATGCC
  27 GTGTTCCTTCATCTTAGCAGTCATTCGTTTCACGGGAAGCCTTGTCCAGTAAGCGGCGGG
  28 CCCATCTGGAGAAATCTCTTCATCAATCGGCTGATGTCCTTCGTTATCGGGGATTCGCGC
  29 ATCTGCAAGGTTGATTGCCACTCGTTCCGGTGTAATCTGCATCCGTCCTCCTGCTTGGCC
  30 GACACAAATTACGATATCTGGCTGATGTTTTTGAATGGCTTGGCGCAGAGTGTCCAGAGC
  31 GGATCTAAAGACGGTTGGAATTTGTTCCGCTGTAATAATGGCTTCTTCTGTCTCGAAGCC
  32 ATTAAGCCGTTTCGCCGCTTCCCATGATGGATTGACGGTTTCTTTGTCAAAAGGGTCAAA
  33 GCCTGTGATCAGCACTTTTTTTCTCATTCTCCCATCTCCTTTTTCTTTTATTCTATTGTT
  34 TATTTATGGGTTTTTCATCAAAATAATGTAAAGGAGTGAATCATAATGGAGCATTTGCCG
  35 GAGCAGTATCGCCAGTTATTCCCAACCTTGCAGACGCATACGATGCTTGCCAGCTGTTCT
  36 CAGAGCGCATTGGCAGAGCCTGTATCAAGGGCGATCCAGGATTATTATGATAGCCTGCTG
  37 TATAAAGGGACGAACTGGAAAGAAGCGATTGAAAAAACAGAGTTTGCGAGAAACGAGTTT
  38 GCAAAGCTGATCGGGGCTGAACCGGATGAAGTGGCGATTGTGCCGTCAGTTTCTGATGCA
  39 CTGGTTTCTGTAGCATCGTCCTTAACTGCATTTGGAAAGAAGCACGTTGTATATACAGAT
  40 ATGGATTTTCCGGCGGTGCCTCATGTTTGGCAGGCACACTCCGATTATACCGTATCCGTC
  41 ATTCCATCAATAGACGGCGTGCTGCCGCTTGAACAATATGAAACGCATATTTCGGATGAA
  42 ACAGTACTGACGTGTGTTCCTCACGTTCATTATCGTGACGGCTATGTTCAGGATATAAAA
  43 GCGATTGCCGAGATTTCTCAGAGAAAGGGCTCTTTATTGTTTGTAGATGCTTATCAATCA
  44 GCCGGGCATATTCCCATTGATGTGAAGGAATGGGGCGTAGATATGCTGGCAGCAGGCACC
  45 CGGAAGTATTTGCTCGGCATACCGGGTGTGGCGTTTCTTTATGTGAGAAAGGAGCTGGCT
  46 GACGCACTGAAGCCGAAAGCATCAGCTTGGTTCGGAAGAGAGAGCGGATTTGATGGGGCT
  47 TATGCAAAAGTCGCGCGCCGTTTTCAAACGGGCACCCCAGCTTTTATCAGCGTATACGCA
  48 GCTGCAGCGGCTTTATCGCTGCTGAATCATATTGGGGTTTCTCATATCAGGGATCATGTG
  49 AAAACGATCTGTGCCGATGCAGTTCAATATGCCGCTGAAAAAGGCCTGCAGCTGGCGGCG
  50 GCACAAGGTGGGATTCAGCCGGGCATGGTTGCGATCCGGGATGAGCGGGCATCGGAAACG
  51 GCGGGGTTGCTGAAGAAGAAAAAAGTGATTTGCGCGCCGCGGGAAAATGTTATCCGTCTC
  52 GCTCCCCATTTTTATAATACGAAGGAGGAAATGCGGCACGCGATTGATGAAATCGCGGCG
  53 AAAACGATCCACAAGTAAACATGAAAAAGCCCCTGAACACTAGTCAGGGGCTTTTCATAT
  54 TAATGATCTACTTTAACGCGTTTCATAAAGAAAGCGCCAATTAAACCGATAATGGCAACA
  55 ATCATTGCAAACACAAATGCGTGCTGTACGCCTGCTGTCAAAGCTTGCGGGATGACTGCC
  56 GGATCGGCAGGGTTTTTAACTGTACTCATATAATCATGCTGGCCTGCAGCCATAATGCTG
  57 ACCGCAACCGCTGTTCCGATAGCGCCGGCCATTTGCTGCAGCGTGTTCATAATGGCGGTG
  58 CCGTCTGGATAAAATTCACGCGGCAGTTGGTTTAAACCGTTTGTCTGTGCAGGCATCATG
  59 ATCATAGAAATCCCGATCATCAAGCAGGTGTGCAGGATGATAATCAGCACAGCTGTTGAA
  60 GTGGTCGTGACATTTGAGAAGAACCATAGTACAACGGTGACAATCACAAATCCCGGAATG
  61 ACAAGCCATTTCGGCCCGTATTTATCGAACAAGCGGCCTGTAACAGGGGACATAAATCCA
  62 TTTAAAATACCGCCCGGCAAGAGAACAAGACCAGATGCAAATGCAGTGAGGACTAAGCCG
  63 CCTTGCAGATACATCGGCAGAAGCAGCATAGATGACAGAATGACCATCATACAAATGAAC
  64 ACCATGATCACACCCAAAATAAACATCGGGTATTTGAACGCACGGAGGTTCATCATAGGC
  65 TGCTTCATTGTCAGCTGGCGGATTGAAAATAAGATAAGGCCGACAACGCCGACAATCAGC
  66 GACACGATAACAGTCGGGCTGGACCATCCCCCGGAGCCTTCACCCGCGTTGCTGAATCCG
  67 AATACAATGCCGCCGAAGCCAATCGTCGACAGGATGATAGACAATACATCGATTTTCGGC
  68 TTTGTCGTTTCAGATACATTTTGCATATATGCGATACCGAAAACAAGCGCCAGCACAAGG
  69 AATGGAAGAGAGATCCAGAAAATCCAGTGCCAGTTGAGATGCTCCAGAACCAATCCTGAG
  70 AAAGTTGGGCCGATGGCGGGCGCGAACATAATGACAAGCCCGATCGTTCCCATTGCGGCA
  71 CCCCGTTTATGAGGCGGGAAAATCACCAAGATTGTGTTAAACATCAGCGGCAGTAAAAGA
  72 CCGGTTCCAAGTGCCTGAACGATCCTTGCCGCTAATAAAAACGAGAAGCTCGGCGCAAGC
  73 GCCGCAATGAATGTACCTAAAATTGAAAAGATAAGTGACACGGTAAAAAGCTGTCTTGTT
  74 GTGAACCACTGCAACAGCAGTCCTGAAACAGGAACAAGGATACCGAGTACAAGCAGGTAG
  75 CCCGTCGTTAACCATTGGACGGTTGCCGCTGTAATGTTCAATTCCTTCATAAGGTCGGTT
  76 AACGCAATATTCAGCGCTGTTTCACTGAACATGCCGATAAAACCGGCCAACAGCAAGGAA
  77 ATCATAATCGGCATCACTTTGTATTGCTGAGATGCTTTAGCTGTTGTTTCCAAAATCATT
  78 TCCCCTCTCTATCAACTGCATGTAGTATGTCGTTTTTTTTATCTCTTCAGCAGGTCAGGA
  79 ATGCAGCTGGAGATATGAAGGAGCGGCGTACTGTTTTTTGCCGTCAAAGATAAAAGGATG
  80 CCGCCTTCAATCATCGCGTTAACCACAGTGCTGGCTTCTTTTGCACGGCTCTCGCTGCAG
  81 CCAGTCTGCCGCAGTTTTTCCTCATACACAGAGGCCCATTCTTTGTAGGCTTCATGACAG
  82 GCTTCGCGCAACGGTTCGCTTTTCAATGACGTCTCAGCCGCTAGCAAGCCCACAGGCAAG
  83 CCTTCAATGTCTTCCGTACATGAAAACTGGCAGGAGAGCTCCTTCAAAAAGGCTTGAATG
  84 CCTTCCGCTGGATCGGTGCAGGCTTCCATGCAGTCCGCGATTTTCTGACGGATATACTCC
  85 TTCATCTCATTCACGGCTTCGATCGCAAGCTGTTCTTTACCCCCGGGAAAGTGGTAGTAA
  86 AGAGAGCCTTTAGGCGCGCCGCTTTCCTTTATAATCTGGTTCAGCCCCGTGCCGTAATAC
  87 CCTTGCAGCTGAAAAAGCCGGGTAGCTGCCGAAAGGATTTTCTCACGGGAATCTCCATAA
  88 CTCATAACATTCCCACCTTACTGAATTGCAATCAAAAATATAGTGACTGGTCTATTATCT
  89 TGATTCAATCATCAATTGTCAAGAAAAATTCATTGTATGAAAAGACAAAAAAAGAAGGAT
  90 ATGACAACAAAAAATACTGAGAGAAAAGCTGACTGATCTTTTGACTGAATAGATAAAATG
  91 TACAATGATTAATCATCATATGGATGTAAGGAGAGAAATAGATGAAAAAACAACGAATGC
  92 TCGTACTTTTTACCGCACTATTGTTTGTTTTTACCGGATGTTCACATTCTCCTGAAACAA
  93 AAGAATCCCCGAAAGAAAAAGCTCAGACACAAAAAGTCTCTTCGGCTTCTGCCTCTGAAA
  94 AAAAGGATCTGCCAAACATTAGAATTTTAGCGACAGGAGGCACGATAGCTGGTGCCGATC
  95 AATCGAAAACCTCAACAACTGAATATAAAGCAGGTGTTGTCGGCGTTGAATCACTGATCG
  96 AGGCAGTTCCAGAAATGAAGGACATTGCAAACGTCAGCGGCGAGCAGATTGTTAACGTCG
  97 GCAGCACAAATATTGATAATAAAATATTGCTGAAGCTGGCGAAACGCATCAACCACTTGC
  98 TCGCTTCAGATGATGTAGACGGAATCGTCGTGACTCATGGAACAGATACATTGGAGGAAA
  99 CCGCTTATTTTTTGAATCTTACCGTGAAAAGTGATAAACCGGTTGTTATTGTCGGTTCGA
 100 TGAGACCTTCCACAGCCATCAGCGCTGATGGGCCTTCTAACCTGTACAATGCAGTGAAAG

Attached Files

To refer to attachments on a page, use attachment:filename, as shown below in the list of files. Do NOT use the URL of the [get] link, since this is subject to change and can break easily.
  • [get | view] (2013-10-14 14:34:24, 6.0 KB) [[attachment:bsubtilis.285000-290999.txt]]
  • [get | view] (2013-10-14 14:35:05, 1278.3 KB) [[attachment:bsubtilis.tout.txt.zip]]
  • [get | view] (2013-10-15 22:35:29, 79842.4 KB) [[attachment:uniprot_sprot.fasta.zip]]
 All files | Selected Files: delete move to page copy to page

You are not allowed to attach a file to this page.